How to use readline () to start from the second line?

I am writing a short Python program that will read a FASTA file, which is usually in this format:

>gi|253795547|ref|NC_012960.1| Candidatus Hodgkinia cicadicola Dsem chromosome, 52 lines
GACGGCTTGTTTGCGTGCGACGAGTTTAGGATTGCTCTTTTGCTAAGCTTGGGGGTTGCGCCCAAAGTGA
TTAGATTTTCCGACAGCGTACGGCGCGCGCTGCTGAACGTGGCCACTGAGCTTACACCTCATTTCAGCGC
TCGCTTGCTGGCGAAGCTGGCAGCAGCTTGTTAATGCTAGTGTTGGGCTCGCCGAAAGCTGGCAGGTCGA

I created another program that reads the first line (aka header) of this FASTA file, and now I want this second program to start reading and printing, starting with the sequence.

How should I do it?

So far I have this:

FASTA = open("test.txt", "r")

def readSeq(FASTA):
    """returns the DNA sequence of a FASTA file"""
    for line in FASTA:
        line = line.strip()
        print line          


readSeq(FASTA)

Thanks guys,

-Noob

+5
source share
5 answers
def readSeq(FASTA):
    """returns the DNA sequence of a FASTA file"""
    _unused = FASTA.next() # skip heading record
    for line in FASTA:
        line = line.strip()
        print line  

Read the docs on file.next () to see why you should be wary of mixing file.readline()withfor line in file:

+5
source

you should show your script. To read from the second line, something like this

f=open("file")
f.readline()
for line in f:
    print line
f.close()
+4
source

BioPythons Fasta ( source).

def FastaIterator(handle, alphabet = single_letter_alphabet, title2ids = None):
    """Generator function to iterate over Fasta records (as SeqRecord objects).

handle - input file
alphabet - optional alphabet
title2ids - A function that, when given the title of the FASTA
file (without the beginning >), will return the id, name and
description (in that order) for the record as a tuple of strings.

If this is not given, then the entire title line will be used
as the description, and the first word as the id and name.

Note that use of title2ids matches that of Bio.Fasta.SequenceParser
but the defaults are slightly different.
"""
    #Skip any text before the first record (e.g. blank lines, comments)
    while True:
        line = handle.readline()
        if line == "" : return #Premature end of file, or just empty?
        if line[0] == ">":
            break

    while True:
        if line[0]!=">":
            raise ValueError("Records in Fasta files should start with '>' character")
        if title2ids:
            id, name, descr = title2ids(line[1:].rstrip())
        else:
            descr = line[1:].rstrip()
            id = descr.split()[0]
            name = id

        lines = []
        line = handle.readline()
        while True:
            if not line : break
            if line[0] == ">": break
            #Remove trailing whitespace, and any internal spaces
            #(and any embedded \r which are possible in mangled files
            #when not opened in universal read lines mode)
            lines.append(line.rstrip().replace(" ","").replace("\r",""))
            line = handle.readline()

        #Return the record and then continue...
        yield SeqRecord(Seq("".join(lines), alphabet),
                         id = id, name = name, description = descr)

        if not line : return #StopIteration
    assert False, "Should not reach this line"
+2

:)

if for line.strip()

def readSeq(FASTA):
    for line in FASTA:
        if line.startswith('>'):
            continue
        line = line.strip()
        print(line)
+1

.

>>> f = open('filename')
>>> lines = f.readlines()
>>> lines[1:]
['TTAGATTTTCCGACAGCGTACGGCGCGCGCTGCTGAACGTGGCCACTGAGCTTACACCTCATTTCAGCGC\n', 'TCGCTTGCTGGCGAAGCTGGCAGCAGCTTGTTAATGCTAGTG
TTGGGCTCGCCGAAAGCTGGCAGGTCGA']

" , ( 1) .

:

s[i:j]  slice of s from i to j
s[i:j:k]    slice of s from i to j with step k (k can be negative to go backward)

i, j ( ), j , .

s[:-1]     All but the last element. 

gnibbler:

, iterator slicing, , , .

import itertools
f = open("filename")
#start at the second line, don't stop, stride by one
for line in itertools.islice(f, 1, None, 1): 
    print line

"islicing" , .

+1

All Articles